What’s Next – Google Brain?What’s Next – Google Brain?
Uses of DNA TechnologyUses of DNA Technology
Find out what genes do (mutate or knockout a developmental gene and see whathappens)Find out what genes do (mutate or knockout a developmental gene and see whathappens)
Make large amounts of a proteinMake large amounts of a protein
In-situ hybridization – can tell if an embryohas a defective geneIn-situ hybridization – can tell if an embryohas a defective gene
Diagnosis, treatment, prevention ofdiseaseDiagnosis, treatment, prevention ofdisease
Study of relatedness of speciesStudy of relatedness of species
Crime SolvingCrime Solving
DNA Technology Uses ContinuedDNA Technology Uses Continued
Study gene expressionStudy gene expression
Study growth and differentiationStudy growth and differentiation
Identify recessive allelesIdentify recessive alleles
Vaccines (make large amounts of proteins thattrigger the immune responseVaccines (make large amounts of proteins thattrigger the immune response
Designer Drugs (anti-fat drugs)Designer Drugs (anti-fat drugs)
RNAi (blocks translation – find out what a genedoes)RNAi (blocks translation – find out what a genedoes)
Gene Therapy (put genes in somatic or germcells)Gene Therapy (put genes in somatic or germcells)
Problems:Problems:
How do you introduce it?How do you introduce it?
How do you control gene expressionHow do you control gene expression
How do you get the gene product where it’s neededHow do you get the gene product where it’s needed
May alter other cell functionsMay alter other cell functions
Eugenics are a worry (controlling the genetic make-up)Eugenics are a worry (controlling the genetic make-up)
Technology #1 – Gene CloningTechnology #1 – Gene Cloning
Gene CloningGene Cloning
Making multiple copies of a gene by putting it in acell that will replicate it and pass it on to offspringMaking multiple copies of a gene by putting it in acell that will replicate it and pass it on to offspring
Although you can make lots of copies of agene in a tt, it will actually produce theprotein if in a cellAlthough you can make lots of copies of agene in a tt, it will actually produce theprotein if in a cell
To clone a gene you will need:restriction enzymes, a vector, and a host cellTo clone a gene you will need:restriction enzymes, a vector, and a host cell
Restriction EnzymesRestriction Enzymes
a.naturally used by bacteria to digest foreignDNAa.naturally used by bacteria to digest foreignDNA
b.Bacteria methylates its DNA (A&C) toprotect itself since methylation preventsDNA digestionb.Bacteria methylates its DNA (A&C) toprotect itself since methylation preventsDNA digestion
c.Can buy and use to cut and insert foreignDNAc.Can buy and use to cut and insert foreignDNA
d.Cut at palindromic sequences – sameforward and back (same 5’-3’ or vice versa)d.Cut at palindromic sequences – sameforward and back (same 5’-3’ or vice versa)
Enzyme
Organism from which derived
Target sequence(cut at *)5' -->3'
Ava I
Anabaena variabilis
C* C/T C G A/G G
Bam HI
Bacillus amyloliquefaciens
G* G A T C C
Bgl II
Bacillus globigii
A* G A T C T
Eco RI
Escherichia coli RY 13
G* A A T T C
Eco RII
Escherichia coli R245
* C C A/T G G
Hae III
Haemophilus aegyptius
G G * C C
Hha I
Haemophilus haemolyticus
G C G * C
Hind III
Haemophilus inflenzae Rd
A* A G C T T
Hpa I
Haemophilus parainflenzae
G T T * A A C
Kpn I
Klebsiella pneumoniae
G G T A C * C
Mbo I
Moraxella bovis
*G A T C
Mbo I
Moraxella bovis
*G A T C
Pst I
Providencia stuartii
C T G C A * G
Sma I
Serratia marcescens
C C C * G G G
SstI
Streptomyces stanford
G A G C T * C
Sal I
Streptomyces albus G
G * T C G A C
Taq I
Thermophilus aquaticus
T * C G A
Xma I
Xanthamonas malvacearum
C * C C G G G
Cloning VectorsSomething to carry gene so it gets copiedCloning VectorsSomething to carry gene so it gets copied
a. Phages (as the phage replicates inside the bacteria sodoes the added gene and it spreads to other bacteria)– holds up to 25kb of DNAa. Phages (as the phage replicates inside the bacteria sodoes the added gene and it spreads to other bacteria)– holds up to 25kb of DNA
b. Plasmids – as bacteria reproduce – clonesgene within the colony – holds up to 12 kbb. Plasmids – as bacteria reproduce – clonesgene within the colony – holds up to 12 kb
c. Retroviruses – have advantage that they canincorporate into the host chromosome in animal cells –Can hold 8-10kbc. Retroviruses – have advantage that they canincorporate into the host chromosome in animal cells –Can hold 8-10kb
d.Yeast artificial chromosomes (YAC’s) – a “fake”chromosome containing foreign DNA with the abilityto replicate and undergo mitosis – up to 3000kbd.Yeast artificial chromosomes (YAC’s) – a “fake”chromosome containing foreign DNA with the abilityto replicate and undergo mitosis – up to 3000kb
e. Bacterial Artificial Chromosomes (BAC’s) – a fakebacterial chromosome – can hold 100-300 kbe. Bacterial Artificial Chromosomes (BAC’s) – a fakebacterial chromosome – can hold 100-300 kb
Example of PlasmidExample of Plasmid
Advantages of Plasmids as VectorsAdvantages of Plasmids as Vectors
Replicate quicklyReplicate quickly
Has an origin of replication so is copiedand passes to daughter cellsHas an origin of replication so is copiedand passes to daughter cells
Doesn’t need to enter genome to becopiedDoesn’t need to enter genome to becopied
Easy to put DNA into plasmidsEasy to put DNA into plasmids
Easy to put plasmids into bacteriaEasy to put plasmids into bacteria
Can incorporate selection factors to makeit easy to find bacteria containing gene ofinterestCan incorporate selection factors to makeit easy to find bacteria containing gene ofinterest
HostHostCan use animal cell, plant cell, yeast cell, or bacteria. Bacteria are theeasiest – can get DNA in to the cell easier and they replicate faster
a. Difficult to put DNA into eukaryotic cells (canelectroporate, inject the DNA, or attach the DNA tometal beads and shoot through membrane with agun) – usually use retroviruses!a. Difficult to put DNA into eukaryotic cells (canelectroporate, inject the DNA, or attach the DNA tometal beads and shoot through membrane with agun) – usually use retroviruses!
b. Although bacteria are easy to use, you can’talways use them because they don’t havemechanisms to cut out introns and don’t do post-translational modifications – if it needs thesemodifications to be functional, must use a eukaryoticcellb. Although bacteria are easy to use, you can’talways use them because they don’t havemechanisms to cut out introns and don’t do post-translational modifications – if it needs thesemodifications to be functional, must use a eukaryoticcell
Making Recombinant DNA:How do you clone a gene and how do findthe cells that have your gene in them?Making Recombinant DNA:How do you clone a gene and how do findthe cells that have your gene in them?
1. Cut out your geneof interest and put it ina vector1. Cut out your geneof interest and put it ina vector
oDigest the plasmidand DNA of interestwith same restrictionenzyme (now havecompatible stickyends)oDigest the plasmidand DNA of interestwith same restrictionenzyme (now havecompatible stickyends)
oSome plasmids willclose up without geneoSome plasmids willclose up without gene
oSome plasmids willget the gene insertedoSome plasmids willget the gene inserted
How to Clone a Gene ContinuedHow to Clone a Gene Continued
2. Transforming Bacteria (putting the geneof interest with the plasmid into the cell)2. Transforming Bacteria (putting the geneof interest with the plasmid into the cell)
Artificial TransformationArtificial Transformation
oNeed competent cells (in exponential growth)oNeed competent cells (in exponential growth)
oPositive ions make cell membranes permeableto DNAoPositive ions make cell membranes permeableto DNA
oCan also use electroporation, heat shockoCan also use electroporation, heat shock
oCan inject the DNAoCan inject the DNA
Gene Cloning ContinuedGene Cloning Continued
3. Selecting cells that have the gene ofinterest3. Selecting cells that have the gene ofinterest
Need to know if the gene is inserted into theplasmid and if the plasmid is inserted into thecellNeed to know if the gene is inserted into theplasmid and if the plasmid is inserted into thecell
A. To see if colony has the plasmid - Use a plasmid thathas antibiotic resistance gene – if plasmid isinserted, it will grow on antibiotic (like ampr – andgrow on amp)A. To see if colony has the plasmid - Use a plasmid thathas antibiotic resistance gene – if plasmid isinserted, it will grow on antibiotic (like ampr – andgrow on amp)
B.To see if plasmid containing colonies haveplasmids with the gene of interest:B.To see if plasmid containing colonies haveplasmids with the gene of interest:
oUse restriction enzymes that cuts in the middle of a colorgene like the β galactosidase gene – if inserted thecolonies will be whiteoUse restriction enzymes that cuts in the middle of a colorgene like the β galactosidase gene – if inserted thecolonies will be white
Selection of cells with gene ofinterest continuedSelection of cells with gene ofinterest continued
oLook for protein products by activity orantibodiesoLook for protein products by activity orantibodies
oMake probes (short pieces of DNA or RNAthat will hybridize (base pair) with the geneof interest – must be radioactive orfluorescent.oMake probes (short pieces of DNA or RNAthat will hybridize (base pair) with the geneof interest – must be radioactive orfluorescent.
oTransfer some cells from each colony to filterpaper, probe, and then match up coloniesoTransfer some cells from each colony to filterpaper, probe, and then match up colonies
Technology #2 – Creating aGenomic LibraryTechnology #2 – Creating aGenomic Library
1.Cut whole genome with restriction enzymes – makessticky ends1.Cut whole genome with restriction enzymes – makessticky ends
2.Cut plasmids with same restriction enzyme to makematching sticky2.Cut plasmids with same restriction enzyme to makematching sticky
3.Mix the 2 together to get a bunch of plasmids – eachwith a piece of the genome3.Mix the 2 together to get a bunch of plasmids – eachwith a piece of the genome
Problems with Genomic LibrariesProblems with Genomic Libraries
1.There are many random fragments1.There are many random fragments
2.Must find the correct gene out of all of the plasmids2.Must find the correct gene out of all of the plasmids
3.Contains introns that bacteria can’t transcribe3.Contains introns that bacteria can’t transcribe
Use samerestriction enzymeto cut genomicDNA and plasmidsto make matchingsticky ends
Making a Genomic Library
Technology #3: Creating acDNA LibraryTechnology #3: Creating acDNA Library
1.1.Create the cDNA(complementary DNA)
Collect all of the mRNA from acell
Use the enzyme reversetranscriptase (from retroviruses)to copy the mRNA into ds DNA
1.1.Cut cDNA with restrictionenzymes, cut plasmids withsame r.e. and mix together
PCR – polymerase chain reactionPCR – polymerase chain reaction
Make millions of copies of a single piece of DNAdue to primers (must know some sequencesflanking the gene)Make millions of copies of a single piece of DNAdue to primers (must know some sequencesflanking the gene)
No need to isolate the gene firstNo need to isolate the gene first
DNA can be old and in very small quantitiesDNA can be old and in very small quantities
Can use for crime detection if only have 1 cell ora small sampleCan use for crime detection if only have 1 cell ora small sample
Can use to amplify a gene of interest beforemaking a library so there is a higherconcentration of that gene in the libraryCan use to amplify a gene of interest beforemaking a library so there is a higherconcentration of that gene in the library
PCRPCR
1.Make primers complementary to the ends ofthe target sequence1.Make primers complementary to the ends ofthe target sequence
2.Heat denature the DNA (960)2.Heat denature the DNA (960)
3.Cool DNA – primers stick (500)3.Cool DNA – primers stick (500)
4.Heat a little and let DNA polymerase copy theds DNA (720)4.Heat a little and let DNA polymerase copy theds DNA (720)
5.Heat denature again5.Heat denature again
6.Cool6.Cool
7.Copy, repeat, repeat, repeat7.Copy, repeat, repeat, repeat
8.30 cycle makes 200 million copies8.30 cycle makes 200 million copies
DoublestrandcDNA
AAAAA
TTTTT
RT
AAAAA
TTTTT
RT
RT
AAAAA
TTTTT
Oligo dT primer isbound to mRNA
Reversetranscriptase(RT) copies firstcDNA strand
Reversetranscriptasedigests anddisplaces mRNAand copiessecond strand ofcDNA
Conversion of mRNA to cDNA by Reverse Transcription
RT PCRRT PCR
A. Doublestrand DNA
B. Denature
96º
50º
C. Annealprimers
50º
D. Polymerasebinds
72º
Taq
Taq
72º
Taq
Taq
E. Copystrands
1
2
3
4
F.Denature
96º
First roundof cDNAsynthesis (4strands)
Taq
Taq
Electrophoresis – Separation ofmolecules based on electricalcharge and sizeElectrophoresis – Separation ofmolecules based on electricalcharge and size
Uses:Uses:
Determine the size of a fragmentDetermine the size of a fragment
Purify plasmidsPurify plasmids
Identify genes through hybridization/ Diagnosisof genetic diseaseIdentify genes through hybridization/ Diagnosisof genetic disease
Sequencing of a geneSequencing of a gene
RFLP or VNTR analysisRFLP or VNTR analysis
Paternity testingPaternity testing
ForensicsForensics
Chromosome mappingChromosome mapping
DNA ElectrophoresisDNA Electrophoresis
Cut up DNA with restriction enzymesCut up DNA with restriction enzymes
Load solution of cut up DNA into a well of anagarose gel (porous gel that acts as a sieve)Load solution of cut up DNA into a well of anagarose gel (porous gel that acts as a sieve)
Apply an electrical current to gelApply an electrical current to gel
DNA is negatively charged so it moves to thepositive pole.DNA is negatively charged so it moves to thepositive pole.
Since the gel isSince the gel is
porous – the smaller porous – the smaller
the piece of DNA – the piece of DNA –
the faster it moves the faster it moves
so it separates by size so it separates by size
Electrophoresis after restrictiondigestionElectrophoresis after restrictiondigestion
TATCTGGAAGTGGTACC GGAATCTACCGGTATCTGGAAGTGGTACC GGAATCTACCGG
TATCCGGAAGTGATACCGGAATCTACCGGTATCCGGAAGTGATACCGGAATCTACCGG
TATCCGGAAGTGGTATCGGAATCTACCGGTATCCGGAAGTGGTATCGGAATCTACCGG
Circular forms of DNA migrate in agarosedistinctly differently from linear DNAs of thesame mass. Typically uncut plasmids will appear tomigrate more rapidly than the same plasmid whenlinearized. Additionally, most preparations of uncutplasmid contain at least two topologically-differentforms of DNA, corresponding to supercoiled formsand nicked circles. The image to the right shows anethidium-stained gel with uncut plasmid in the leftlane and the same plasmid linearized at a singlesite in the right lane.
Plasmid PurificationWhat a cut vs. uncut plasmidlooks likePlasmid PurificationWhat a cut vs. uncut plasmidlooks like
Gene IdentificationIf the DNA is purifiedGene IdentificationIf the DNA is purified
Cut the DNACut the DNA
Run gel (DNA runs toward the + pole)Run gel (DNA runs toward the + pole)
Stain if have purified geneStain if have purified gene
CCG↓CGGTAGGAAC CCACGGTAGGAAC CCG↓CGGTAGGAAC CCACGGTAGGAAC
____ ____
________
________
Gene IdentificationUsing Genomic DNAGene IdentificationUsing Genomic DNA
Cut the DNACut the DNA
Run gel (DNA runs toward the + pole)Run gel (DNA runs toward the + pole)
If stained the gel – big smear of DNA becauseso many bandsIf stained the gel – big smear of DNA becauseso many bands
Southern Blot and ProbeSouthern Blot and Probe
Probe = ATCCTTProbe = ATCCTT
CCG↓CGGTAGGAAC CCACGGTAGGAAC CCG↓CGGTAGGAAC CCACGGTAGGAAC
____ ____
________
Southern BlottingSouthern Blotting
Denature DNA in gelDenature DNA in gel
Transfer to Nitrocellulose paper bycapillary actionTransfer to Nitrocellulose paper bycapillary action
Probe with labeled probesProbe with labeled probes
Wash non-specific probe off of paperWash non-specific probe off of paper
Expose to filmExpose to film
Can see if a DNA sequence is there, howmany fragments, size of fragmentsCan see if a DNA sequence is there, howmany fragments, size of fragments
Stain vs. Southern Blot withGenomic DNAStain vs. Southern Blot withGenomic DNA
Bacterial DNA Cut with aRestriction EnzymeLeft is stained/ Right is Blotted and ProbedBacterial DNA Cut with aRestriction EnzymeLeft is stained/ Right is Blotted and Probed
Other Blotting TechniquesOther Blotting Techniques
Northern – same but using RNA instead ofDNANorthern – same but using RNA instead ofDNA
Western Blotting – electrical transfer ofproteins to paper and then usingfluorescently or radioactively taggedantibodies to identify proteinWestern Blotting – electrical transfer ofproteins to paper and then usingfluorescently or radioactively taggedantibodies to identify protein
Alternative for Genetic DiseaseDiagnosisAlternative for Genetic DiseaseDiagnosis
Can diagnose diseases without gels usingRT-PCRCan diagnose diseases without gels usingRT-PCR
Collect cells – do PCR of a particular geneCollect cells – do PCR of a particular gene
Sequence the gene to see if it is normal ormutatedSequence the gene to see if it is normal ormutated
Aside – can find presence of infectiousviruses this way – collect blood or cellsand PCR viral genes – run on gel orsequence to see if presentAside – can find presence of infectiousviruses this way – collect blood or cellsand PCR viral genes – run on gel orsequence to see if present
RFLP or STR – Paternity Testingand DNA FingerprintingRFLP or STR – Paternity Testingand DNA Fingerprinting
RFLP – restriction fragment length polymorphismsRFLP – restriction fragment length polymorphisms
Same as a Southern Blot but usuallyprobe for non-coding regions of DNA thatare highly variable (usually these regionsare more variable than actual genes)Same as a Southern Blot but usuallyprobe for non-coding regions of DNA thatare highly variable (usually these regionsare more variable than actual genes)
Usually use multiple probesUsually use multiple probes
STR (short tandem repeats)STR (short tandem repeats)
Found to be the most variable amonghumans – makes fragments of differentsizes if different number of repeats insatellite DNAFound to be the most variable amonghumans – makes fragments of differentsizes if different number of repeats insatellite DNA
DNA Fingerprinting
Must do stats for each probe – what is the % ofpeople that carry each restriction pattern for thatprobe
The more probes, the more sure you can be thatthe pattern fits only one person
6 probes is very good
Probe 1 – 1/10 exhibit this pattern
Probe 2 – 1/20
Probe 3 – 1/100
Probe 4 – 1/10
Probe 5 – 1/50
Probe 6 – 1/5
What is the chance that this profile can belong toanother person?
1/50,000,000
Combined DNA IndexSystem
Run by the FBI
Has over 5 million convictedoffender DNA profiles
Mandatory to have DNA profile inCODIS if involved in a homicide orsex crime
Uses 13 different loci to look at 13different areas for differences intheir STR
Creates a unique pattern – 1 in 10billion have matching pattern
Paternity TestingPaternity Testing
Run standard RFLP analysisusing 3-4 probesRun standard RFLP analysisusing 3-4 probes
The child gets 2 copies of everygene – 1 from each parentThe child gets 2 copies of everygene – 1 from each parent
Every allele the child has, mustcome from the mother or fatherEvery allele the child has, mustcome from the mother or father
Alleged fathers can be excludedbut many times if the patternmatches – there is only a 99%chance that he is the fatherAlleged fathers can be excludedbut many times if the patternmatches – there is only a 99%chance that he is the father
Usually about 1/100 peoplehave that same patternUsually about 1/100 peoplehave that same pattern
Sequencing – Sanger MethodSequencing – Sanger Method
Cut DNA with restriction enzymesCut DNA with restriction enzymes
Divide into 4 reaction tubes with all the stuff forreplication – (DNA polymerase, ligase,triphosphate nucleotides)Divide into 4 reaction tubes with all the stuff forreplication – (DNA polymerase, ligase,triphosphate nucleotides)
Add ddATP to 1 tube, ddTTP to 1 tube, ddGTPto 1 tube, ddCTP to another tubeAdd ddATP to 1 tube, ddTTP to 1 tube, ddGTPto 1 tube, ddCTP to another tube
As DNA copies, eventually each nucleotide willbe “labeled”As DNA copies, eventually each nucleotide willbe “labeled”
Longest fragments at top, smallest at bottom,read from the bottom upLongest fragments at top, smallest at bottom,read from the bottom up
Can do in one tube with fluorescently labeledddnucleotides – A,T,G,C a different colorCan do in one tube with fluorescently labeledddnucleotides – A,T,G,C a different color
Instruments for SequencingInstruments for Sequencing
New InstrumentsNew Instruments
Microarray AnalysisMicroarray Analysis
Gives the ability to compare gene expression between:Gives the ability to compare gene expression between:
Different tissuesDifferent tissues
Different speciesDifferent species
Different stages of developmentDifferent stages of development
Cancer vs. non-cancerCancer vs. non-cancer
Healthy vs. diseased tissueHealthy vs. diseased tissue
Procedure:Procedure:
Make the microarray plate (a robot attaches single strandedpieces of DNA to a glass plate including every gene in thegenome)Make the microarray plate (a robot attaches single strandedpieces of DNA to a glass plate including every gene in thegenome)
Make cDNA from all mRNA in each of the two cell types youwant to compareMake cDNA from all mRNA in each of the two cell types youwant to compare
Make the cDNA ss and attach a red tag to the cDNA from onecell type and a green tag to the cDNA from the other cell typeMake the cDNA ss and attach a red tag to the cDNA from onecell type and a green tag to the cDNA from the other cell type
Add the tagged cDNA’s to the plate and let them hybridizeAdd the tagged cDNA’s to the plate and let them hybridize
If the spot on the plate is red – it is only expressed in that celltype, if it is green – only expressed in the other cell type, yellow– expressed in both (can even tell concentration differences)If the spot on the plate is red – it is only expressed in that celltype, if it is green – only expressed in the other cell type, yellow– expressed in both (can even tell concentration differences)
Affix ss genes toglass plateAffix ss genes toglass plate
Represents allgenes of genomeRepresents allgenes of genome
A scanner reads theamount of redfluorescence andgreen fluorescenceseparately so you caneven tell slightdifferences in geneexpression betweenthe two samples
In-Vitro Mutagenesis andTransgenicsIn-Vitro Mutagenesis andTransgenics
Try to get a handle on the function of thegeneTry to get a handle on the function of thegene
Can change a gene and put it in a cell andsee the effect on the cellCan change a gene and put it in a cell andsee the effect on the cell
Can mutate a gene in an embryonic celland have it try to develop and see whathappens in development or in adulthoodCan mutate a gene in an embryonic celland have it try to develop and see whathappens in development or in adulthood
Cloning of OrganismsCloning of Organisms
Destroy DNA in eggDestroy DNA in egg
Put DNA from an adult somatic cell into the eggPut DNA from an adult somatic cell into the egg
Put the egg into a female host uterus anddevelop into a new organismPut the egg into a female host uterus anddevelop into a new organism
Most are messed up, develop diseases, or dieprematurelyMost are messed up, develop diseases, or dieprematurely
Using DNA with epigenetics (methylation,acetylation patterns) of an adult cell – not of anembryo – affects gene expression!Using DNA with epigenetics (methylation,acetylation patterns) of an adult cell – not of anembryo – affects gene expression!
Embryo farms – grow balls of cells that areclones to use for stem cells to grow new parts –ethical?????Embryo farms – grow balls of cells that areclones to use for stem cells to grow new parts –ethical?????
Stem Cell ResearchStem Cell Research
Pluripotent embryonic stem cells can becomeany kind of cellPluripotent embryonic stem cells can becomeany kind of cell
Adult stem cells become a particular kind of cellor one of a few kinds of cellsAdult stem cells become a particular kind of cellor one of a few kinds of cells
Working on taking normal differentiated cellsand turning them back into stem cells so can usethem to make different kinds of cells (ex. Skinbecomes stem cell becomes a neuron)Working on taking normal differentiated cellsand turning them back into stem cells so can usethem to make different kinds of cells (ex. Skinbecomes stem cell becomes a neuron)
Ethical issues? – where are we getting themfrom?Ethical issues? – where are we getting themfrom?
Found some stem cells in brain – can makesome new neurons!Found some stem cells in brain – can makesome new neurons!